Chromosomal mapping of the tankyrase gene in human and mouse.

Functional gene description: Tankyrase (TNKS) is a ovel gene with homology to both ankyrins and the cataytic domain of poly(ADP-ribose) polymerase (PARP) that as recently cloned using a yeast two-hybrid screen with he telomere-specific DNA binding protein TRF1 (1). ankyrase protein is located at telomeres, centrosomes, nd nuclear pore complexes (1; S. Smith and T. de Lange, n preparation). In vitro studies have demonstrated that ankyrase has PARP activity and that both tankyrase and RF1 can function as acceptors for ADP ribosylation. Since DP ribosylation of TRF1 decreases its telomeric DNA inding activity in vitro, the TNKS gene may function by odulating telomere length. Description of clone or DNA: For human TNKS maping, a PCR specific for the TNKS gene was utilized. The rimers (forward, 59CGAAGTGCTAGGGGAGTCCG; reerse, 59GTGGGAGAGGCTGGG GTGGT) amplified a 69-bp fragment from the TNKS gene (Accession No. FO82556). For mouse Tnks mapping, a mouse EST (Accesion No. AA415426) that had 98% sequence homology with uman TNKS was used. Source: The source of cDNA, as described above, was equence from a human cDNA clone and a mouse cDNA lone. Method used to validate gene identity: Gene identity as validated by specific amplification and, for the mouse ST, stringent hybridization to a single disparate-sized retriction fragment in the two species of mouse used in the apping panel.